Genetic analysis of a child with Charlevoix-Saguenay spastic ataxia due to variant of SACS gene / 中华医学遗传学杂志

OBJECTIVE@#To explore the clinical feature and genetic variant of a child with autosomal recessive Charlevoix-Saguenay type spastic ataxia (ARSACS).@*METHODS@#Clinical data of a child who was admitted to the West China Second Hospital of Sichuan University on April 30, 2021 was collected. Whole exome sequencing (WES) was carried out for the child and his parents. Candidate variants were verified by Sanger sequencing and bioinformatic analysis based on the guidelines from the American College of Medical Genetics and Genomics (ACMG).@*RESULTS@#The child, a 3-year-and-3-month-old female, had a complain of "walking instability for over a year". Physical and laboratory examination revealed progressive and aggravated gait instability, increased muscle tone of the right limbs, peripheral neuropathy of the lower limbs, and thickening of retinal nerve fiber layer. The results of WES revealed that she has harbored a maternally derived heterozygous deletion of exons 1 to 10 of the SACS gene, in addition with a de novo heterozygous c.3328dupA variant in exon 10 of the SACS gene. Based on the ACMG guidelines, the exons 1-10 deletion was rated as likely pathogenic (PVS1+PM2_Supporting), and the c.3328dupA was rated as a pathogenic variant (PVS1_Strong+PS2+PM2_Supporting). Neither variant was recorded in the human population databases.@*CONCLUSION@#The c.3328dupA variant and the deletion of exons 1-10 of the SACS gene probably underlay the ARSACS in this patient.

Identification of heat shock protein hsp70 family genes from Rana amurensis and its expression profiles upon infection / 生物工程学报

Heat shock proteins (HSPs) widely exist in all organisms, the structures of which are usually extraordinarily conservative. They are also well-known stress proteins that are involved in response to physical, chemical and biological stresses. HSP70 is an important member of the HSPs family. In order to study the roles of amphibians HSP70 during infection, the cDNA sequence of Rana amurensis hsp70 family genes were cloned by homologous cloning method. The sequence characteristics, three-dimensional structure and genetic relationship of Ra-hsp70s were analyzed by bioinformatics methods. The expression profiles under bacterial infection were also analyzed by real-time quantitative PCR (qRT-PCR). Expression and localization of HSP70 protein were tested by immunohistochemical techniques. The results showed that three conservative tag sequences of HSP70 family, HSPA5, HSPA8 and HSPA13, were found in HSP70. Phylogenetic tree analysis indicated four members are distributed in four different branches, and members with the same subcellular localization motif are distributed in the same branch. The relative expression levels of the mRNA of four members were all significantly upregulated (P < 0.01) upon infection, but the time for up-regulating the expression levels were diverse in different tissues. The immunohistochemical analysis showed that HSP70 was expressed to different degrees in the cytoplasm of liver, kidney, skin and stomach tissue. The four members of Ra-hsp70 family have ability to respond bacterial infection to varying degrees. Therefore, it was proposed that they are involved in biological processes against pathogen and play different biological functions. The study provides a theoretical basis for functional studies of HSP70 gene in amphibians.

Proteolytic activity of recombinant DegP from Chromohalobacter salexigens BKL5

Background: DegP is a serine protease that specifically cleaves and refolds unfolding proteins in the periplasmic space of the cells. To date, there is no information regarding DegP from halophilic bacteria. Chromohalobacter salexigens BKL5 is a moderately halophilic bacterium that has the ability to grow in a media containing more than 15% salt. Therefore, the objectives of this work were to clone and overexpress DegP-encoding gene from C. salexigens BKL5 and characterize its biochemical properties. Results: DegP-encoding gene was overexpressed in Escherichia coli BL21(DE3) CodonPlus in an active form. SDS-PAGE analysis showed that the molecular weight of the recombinant DegP was 45 kDa. Size-exclusion chromatography analysis suggested that recombinant DegP was present in two multimeric states, hexameric and dodecameric, with molecular weights of 297.9 and 579.12 kDa, respectively. Both conformations were enzymatically active when casein was used as substrate for enzymatic assay. Circular dichroism analysis showed that recombinant DegP was composed of 0.21­0.29 helical content, which was comparable to the helical content in the crystal structure of E. coli DegP. The basic/acidic residue ratio of recombinant DegP was 0.56, which was slightly higher than that of DegP from extreme halophiles (average, 0.45) but significantly lower than that of DegP from nonhalophiles (average, 0.94). Conclusions: Recombinant DegP from C. salexigens BKL5 showed proteolytic activity when ß-casein was used as a substrate. In silico analysis indicated that recombinant DegP had characteristics similar to those of halophilic proteins depending on its amino acid composition.

Autosomal recessive spastic ataxia of Charlevoix-Saguenay: a family report from South Brazil / Ataxia espástica autossômica recessiva de Charlevoix-Saguenay: relato de uma família do sul do Brasil

ABSTRACT Autosomal recessive spastic ataxia of Charlevoix-Saguenay (ARSACS) is an early-onset, neurodegenerative disorder caused by mutations in SACS, firstly reported in Quebec, Canada. The disorder is typically characterized by childhood onset ataxia, spasticity, neuropathy and retinal hypermyelination. The clinical picture of patients born outside Quebec, however, is often atypical. In the present article, the authors describe clinical and neuroradiological findings that raised the suspicion of an ARSACS diagnosis in two female cousins with Germanic background from Rio Grande do Sul, Brazil. We present a review on the neuroimaging, ophthalmologic and neurophysiologic clues for ARSACS diagnosis. The early-onset, slowly progressive, spastic-ataxia phenotype of reported patients was similar to ARSACS patients from Quebec. The SACS sequencing revealed the novel homozygous c.5150_5151insA frameshift mutation confirming the ARSACS diagnosis. ARSACS is a frequent cause of early onset ataxia/spastic-ataxia worldwide, with unknown frequency in Brazil.

RESUMO A ataxia espástica autossômica recessiva de Charlevoix-Saguenay (ARSACS) é uma doença neurodegenerativa de início precoce causada por mutações no gene SACS que foi inicialmente descrita na região de Quebec, Canadá. A apresentação típica de ARSACS é caracterizada por ataxia, espasticidade, polineuropatia e hipermielinização das fibras nervosas da retina de início infantil. No presente artigo, descrevemos os achados clínicos e neurorradiológicos que levaram à suspeita de ARSACS em duas primas descendentes de alemães naturais do Rio Grande do Sul, Brasil e revisamos os achados de neuroimagem, oftalmológicos e neurofisiológicos de ARSACS. O fenótipo de ataxia-espástica de início infantil precoce apresentado pelas pacientes era similar ao classicamente descrito em Quebec. O sequenciamento do SACS revelou a mutação nova c.5150_5151insA (mudança na matriz de leitura), em homozigose, confirmando o diagnóstico de ARSACS. A ARSACS é uma causa frequente de ataxia/ataxia-espástica de início precoce mundialmente, entretanto sua frequência é desconhecida no Brasil.

Detection of Rickettsia bellii and Rickettsia amblyommii in Amblyomma longirostre (Acari: Ixodidae) from Bahia state, Northeast Brazil

Studies investigating rickettsial infections in ticks parasitizing wild animals in the Northeast region of Brazil have been confined to the detection of Rickettsia amblyommii in immature stages of Amblyomma longirostre collected from birds in the state of Bahia, and in immatures and females of Amblyomma auriculariumcollected from the striped hog-nosed skunk (Conepatus semistriatus) and armadillos (Euphractus sexcinctus) in the state of Pernambuco. The current study extends the distribution of R. amblyommii (strain Aranha), which was detected in A. longirostre collected from the thin-spined porcupine Chaetomys subspinosus and the hairy dwarf porcupine Coendou insidiosus. In addition, we report the first detection of Rickettsia bellii in adults of A. longirostre collected from C. insidiosus in the state of Bahia.

Partial characterization of Plasmodium falciparum trophozoite proteome under treatment with quinine, mefloquine and the natural antiplasmodial diosgenone / Caracterización parcial del proteoma del trofozoíto de Plasmodium falciparum bajo tratamiento con quinina, mefloquina y el compuesto natural diosgenona

Introduction: Despite efforts to control malaria, around 10% of the world population is at risk of acquiring this disease. Plasmodium falciparum accounts for the majority of severe cases and deaths. Malaria control programs have failed due to the therapeutic failure of first-line antimalarials and to parasite resistance. Thus, new and better therapeutic alternatives are required. Proteomic analysis allows determination of protein expression levels under drug pressure, leading to the identification of new therapeutic drug targets and their mechanisms of action. Objective: The aim of this study was to analyze qualitatively the expression of P.falciparum trophozoite proteins (strain ITG2), after exposure to antimalarial drugs, through a proteomic approach. Materials and methods: In vitro cultured synchronized parasites were treated with quinine, mefloquine and the natural antiplasmodial diosgenone. Protein extracts were prepared and analyzed by two-dimensional electrophoresis. The differentially expressed proteins were selected and identified by MALDI-TOF mass spectrometry. Results: The following proteins were identified among those differentially expressed in the parasite in the presence of the drugs tested: enolase (PF10_0155), calcium-binding protein (PF11_0098), chaperonin (PFL0740c), the host cell invasion protein (PF10_0268) and proteins related to redox processes (MAL8P1.17). These findings are consistent with results of previous studies where the parasite was submitted to pressure with other antimalarial drugs. Conclusion: The observed changes in the P. falciparum trophozoite protein profile induced by antimalarial drugs involved proteins mainly related to the general stress response.

Introducción. A pesar de los esfuerzos para controlar la malaria, esta sigue siendo un problema de salud pública. Plasmodium falciparum es responsable de la mayoría de los casos graves y de las muertes. Los programas de control de la malaria han sido cuestionados debido al fracaso del tratamiento y a la resistencia del parásito a los antipalúdicos de primera línea, por lo que se requieren nuevas y mejores alternativas. El análisis proteómico permite identificar y determinar los niveles de expresión de las proteínas bajo la presión de los medicamentos, lo que posibilita la identificación de nuevos blancos terapéuticos y mecanismos de acción. Objetivo. Analizar cualitativamente la expresión diferencial de proteínas del citosol del trofozoíto de P. falciparum bajo tratamiento con quinina, mefloquina y el compuesto natural diosgenona mediante una aproximación proteómica. Materiales y métodos. Se trataron trofozoítos sincronizados y cultivados in vitro de P. falciparum (cepa ITG2) con quinina, mefloquina y el compuesto natural diosgenona. Los extractos proteicos se prepararon y analizaron por electroforesis bidimensional. Las proteínas con aparente expresión diferencial se seleccionaron e identificaron mediante espectrometría de masas MALDI-TOF. Resultados. Se encontraron las siguientes proteínas diferencialmente expresadas en el trofozoíto: la enolasa (PF10_0155), la proteína de unión a calcio (PF11_0098), la chaperonina (PFL0740c), la proteína de invasión a la célula del huésped (PF10_0268) y la proteína relacionada con procesos de reducción y oxidación (redox) (MAL8P1.17). Estos hallazgos son congruentes con resultados previos de estudios en los que el parásito fue presionado con otros medicamentos antipalúdicos. Conclusión. Los cambios observados en el perfil de proteínas del trofozoíto de P. falciparum tratado con antipalúdicos involucraron preferencialmente proteínas relacionadas con la respuesta al estrés general.

Role of Endoplasmic Reticulum Stress in Rheumatoid Arthritis Pathogenesis

Rheumatoid arthritis (RA) is a chronic inflammatory disease characterized by abnormal proliferation of synoviocytes, leukocyte infiltration, and angiogenesis. The endoplasmic reticulum (ER) is the site of biosynthesis for all secreted and membrane proteins. The accumulation of unfolded proteins in the ER leads to a condition known as ER stress. Failure of the ER's adaptive capacity results in abnormal activation of the unfolded protein response. Recently, we have demonstrated that ER stress-associated gene signatures are highly expressed in RA synovium and synovial cells. Mice with Grp78 haploinsufficiency exhibit the suppression of experimentally induced arthritis, suggesting that the ER chaperone GRP78 is crucial for RA pathogenesis. Moreover, increasing evidence has suggested that GRP78 participates in antibody generation, T cell proliferation, and pro-inflammatory cytokine production, and is therefore one of the potential therapeutic targets for RA. In this review, we discuss the putative, pathophysiological roles of ER stress and GRP78 in RA pathogenesis.

Effect of dexamethasone on unfolded protein response genes (MTJ1, Grp78, Grp94, CHOP, HMOX-1) in HEp2 cell line.

The endoplasmic reticulum (ER) is related to the various signal routes that are activated in unfolded protein response (UPR). The Grp78, Grp94, CHOP, MTJ1 and HMOX1 genes expressions demonstrate UPR activity. In this study, we investigated the UPR gene expressions in larynx epidermoid carcinoma (HEp2) to which dexamethasone (dex) was applied. HEp2 cells were administered for 48 h with different combinations using 0.1 μM and 1 μM dex, 1 mM phenyl butyric acid (PBA) and 100 ng/ml lipopolysaccharide (LPS). The Grp78, Grp94, CHOP, MTJ1 and HMOX1 genes expression was determined using quantitative RT-PCR. The Grp78, MTJ1 and HMOX1 gene expression increased with the administration of 1 µM dex. CHOP expression, on the other hand, decreased with 0.1 µM dex. When dex was combined with LPS, nearly all gene expressions decreased. The increase in Grp78, Grp94, HMOX1 and MTJ1 gene expression was greater in groups in which dex was administered in combination with PBA than in groups in which dex was administered alone. Dex in low dose (0.1 μM) caused a decrease in CHOP expression in HEp2 cells and an increase in Grp78 expression, in particular. The changes in UPR genes expressions may lead to the extended survival of the cells.

In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes) rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction) has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO). A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB) followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT) complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR). PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%), followed by fish meat (4.0%), and then beef (2.5%). Among various milk and milk products, curd (2.0%) showed the highest prevalence, followed by raw milk (1.3%). The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS) examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro) resulted positive in twenty four strong haemolysin producing L. monocytogenes isolates. The vero cytotoxicity assay could be suggested as a further step towards an alternative assay for detection of haemolytic strains of L. monocytogenes.

Histopathological and molecular characterization of encephalitic listeriosis in small ruminants from northern Paraná, Brazil

Listeriosis is a disease primarily of ruminants caused by the Gram-positive bacterium Listeria monocytogenes. Ruminants either demonstrate manifestations of the encephalitic, septicemic, or reproductive form of listeriosis. The pathological and molecular findings with encephalitic listeriosis in a 5.5-month-old, male, mixed-breed goat and a 3-year-old Texel-crossed sheep from northern Paraná, Brazil are described. Clinically, the kid demonstrated circling, lateral protrusion of the tongue, head tilt, and convulsions; the ewe presented ataxia, motor incoordination, and lateral decumbency. Brainstem dysfunctions were diagnosed clinically and listeriosis was suspected. Necropsy performed on both animals did not reveal remarkable gross lesions; significant histopathological alterations were restricted to the brainstem (medulla oblongata; rhombencephalitis) and were characterized as meningoencephalitis that consisted of extensive mononuclear perivascular cuffings, neutrophilic and macrophagic microabscesses, and neuroparenchymal necrosis. PCR assay and direct sequencing, using genomic bacterial DNA derived from the brainstem of both animals, amplified the desired 174 base pairs length amplicon of the listeriolysin O gene of L. monocytogenes. Phylogenetic analyses demonstrated that the strains associated with rhombencephalitis during this study clustered with known strains of L. monocytogenes lineage I from diverse geographical locations and from cattle of the state of Paraná with encephalitic listeriosis. Consequently, these strains should be classified as L. monocytogenes lineage I. These results confirm the active participation of lineage I strains of L. monocytogenes in the etiopathogenesis of the brainstem dysfunctions observed during this study, probably represent the first characterization of small ruminant listeriosis by molecular techniques in Latin America, and suggest that ruminants within the state of Paraná were infected by the strains of the same lineage of L. monocytogenes.

Greenhouse evaluation on the performance of heat tolerant transgenic broccoli and genetic diversity analysis using inter simple sequence repeat (ISSR) markers

Background: Broccoli, Brassica oleracea subsp. italica is one of the many valuable Brassica species which is still less cultured under in vitro condition. Heat tolerant transgenic and non-transgenic broccoli cv. Green Marvel plantlets with well-developed root system obtained through in vitro culture were transferred into disposable plastic pots containing sterilized potting mixture consisting of (peatgroTM) + coconut dust (2:1) and maintained in a growth chamber. Results: After one month, the hardened plantlets were transferred and maintained in a transgenic greenhouse. After four months of acclimatization in the transgenic greenhouse, the efficacy of HSP101 gene in increasing the heat tolerance of the transgenic broccoli was evaluated. Results showed that the transgenic plants could survive and performed normally, producing flower heads even at the highest tested temperature of 34ºC. Seven transgenic broccoli lines with different gene copy number of the AtHSP101 gene as well as the control plant were assessed for genetic diversity using inter simple sequence repeat (ISSR) markers. Conclusions: ISSR results showed polymorphism and phylogenetic relationship between the transgenic and non-transgenic (control) Brassica oleracea cv. Green Marvel.

production of molecular clones of toxoplasma gondii-derived heat shock protein 70 kDa

Toxoplasmosis is a common and widespread infection in humans and many other species of warmblooded animals. Toxoplasma gondii-derived heat shock protein 70 [Hsp70] may play an important role in the virulence of Toxoplasma gondii [T. gondii]. In the present study, T. gondii Hsp70 was amplified by polymerase chain reaction [PCR] from the DNA of the T. gondiitachyzoite RH strain through the use of specific primers with Xho1 and Xba1 restriction sites. The purified DNA fragment of the T. gondii Hsp70 gene was subcloned into the Xho1 and Xba1-digested eukaryotic expression vector, pcDNA3, and subsequently transformed into TOP10 chemically competent cells. A 2004 base pair [bp] band of PCR product was observed on the 0.8% agarose gel. The cDNA was inserted into the pTZ57R/T vector and then subcloned successfully into the pcDNA3 eukaryotic expression plasmid vector. The sequence of this amplified gene showed up to 100% homology with the target gene according to the Genbank database [Accession no. U82281]

Sterol-independent repression of low density lipoprotein receptor promoter by peroxisome proliferator activated receptor gamma coactivator-1alpha (PGC-1alpha)

Peroxisome proliferator activated receptor (PPAR) gamma coactivator-1alpha (PGC-1alpha) may be implicated in cholesterol metabolism since PGC-1alpha co-activates estrogen receptor alpha (ERalpha) transactivity and estrogen/ERalpha induces the transcription of LDL receptor (LDLR). Here, we show that overexpression of PGC-1alpha in HepG2 cells represses the gene expression of LDLR and does not affect the ERalpha-induced LDLR expression. PGC-1alpha suppressed the LDLR promoter-luciferase (pLR1563-luc) activity regardless of cholesterol or functional sterol-regulatory element-1. Serial deletions of the LDLR promoter revealed that the inhibition by PGC-1alpha required the LDLR promoter regions between -650 bp and -974 bp. Phosphorylation of PGC-1alpha may not affect the suppression of LDLR expression because treatment of SB202190, a p38 MAP kinase inhibitor, did not reverse the LDLR down-regulation by PGC-1alpha. This may be the first report showing the repressive function of PGC-1alpha on gene expression. PGC-1alpha might be a novel modulator of LDLR gene expression in a sterol-independent manner, and implicated in atherogenesis.

Induction of unfolded protein response during neuronal induction of rat bone marrow stromal cells and mouse embryonic stem cells

When we treated rat bone marrow stromal cells (rBMSCs) with neuronal differentiation induction media, typical unfolded protein response (UPR) was observed. BIP/GRP78 protein expression was time-dependently increased, and three branches of UPR were all activated. ATF6 increased the transcription of XBP1 which was successfully spliced by IRE1. PERK was phosphorylated and it was followed by eIF2alpha phosphorylation. Transcription of two downstream targets of eIF2alpha, ATF4 and CHOP/GADD153, were transiently up-regulated with the peak level at 24 h. Immunocytochemical study showed clear coexpression of BIP and ATF4 with NeuN and Map2, respectively. UPR was also observed during the neuronal differentiation of mouse embryonic stem (mES) cells. Finally, chemical endoplasmic reticulum (ER) stress inducers, thapsigargin, tunicamycin, and brefeldin A, dose-dependently increased both mRNA and protein expressions of NF-L, and, its expression was specific to BIP-positive rBMSCs. Our results showing the induction of UPR during neuronal differentiations of rBMSCs and mES cells as well as NF-L expression by ER stress inducers strongly suggest the potential role of UPR in neuronal differentiation.

Cloning and expression analysis of a small HSP26 gene of Pacific abalone (Haliotis discus hannai).

Heat shock proteins (HSPs) are evolutionally conserved from micro organism to mammals and play important roles in many biological processes including thermal tolerance. We isolated a homologue of small HSP26 (sHSP26) from a subtracted cDNA library of heat shock-treated abalone (Haliotis discus hannai). The abalone sHSP26 encompossed 793 nt, including a coding region of 501 nt. The deduced amino acid sequence of the abalone sHSP26 contained well conserved alpha-crystallin domain and showed overall identities of 27-31% with the other species' sHSP proteins. The abalone sHSP26 transcript was induced by heat shock treatment, but not by cold shock treatment.

[Characterization of 60 kDa heat shock protein [HSP60] gene in pathogenic dermatophyte Microsporom canis]

The stress-inducible Heat Shock Proteins [i.e. HSP60] constitute one of the highly conserved protein and gene families. As one of the molecular chaperone proteins, they play essential roles in protein metabolism and protein translocation under both stress and non-stress conditions. In the present study, we try to characterize the 60 kDa Heat Shock Protein [HSP60] gene in dermatophyte pathogen Microsporom Canis [M. canis]. This dermatophyte is one of the most important causative agents of dermatophytosis in human and animals. Some properties of M. canis have been investigated in molecular level; however, no information is available regarding the HSP60 in this dermatophyte. In the present study, we try to characterize the 60 kDa Heat Shock Protein [HSP60] gene in dermatophyte pathogen Microsporom Canis [M. canis]. M. canis was obtained from patients with dermatophytosis and cultured in appropriate conditions. High molecular weight DNA was isolated from obtained mycelial mass by standard methods. Pairs of 21 nt primers were designed from highly conserved regions of the HSP60 genes in other eukaryotic cells. Mentioned primers were utilized in PCR using isolated genomic DNA template of M. canis. Predicted molecules have been amplified and were submitted for sequencing. By the time 1550 nucleotides of this gene are sequenced and analysed, that encoding a 497 amino acids protein. In the present study, we report the identification and molecular characterization of a M. canis gene encoding a protein belongs to the 60 kDa Heat Shock Protein family which will here be referred to as McHSP60. Analysis of the amino acid sequence of this gene revealed a considerable identity with other eukaryotic HSP60 such as those of C.immitis [97%], Aspergillus fumigatus [92%] and S.cerevisiae [74%]. Investigation of amino acid composition in HSP60 revealed Alanine, Glutamic acid and Glysine as the most common amino acids in this protein. The amino acid composition of McHSP60 indicates the amount of Cysteine and Tryptophan are poor

Identification & differentiation of Mycobacterium avium & M. intracellulare by PCR- RFLP assay using the groES gene.

BACKGROUND & OBJECTIVE: We report a new polymerase chain reaction (PCR) - restriction fragment length polymorphism (RFLP) assay using mycobacterial groES as a target to identify Mycobacterium avium and M. intracellulare in clinical samples. METHODS: The assay was standardized using M. avium and M. intracellulare standard strains obtained from ATCC and was tested with 45 M. avium-M. intracellulare complex (MAC) clinical isolates (Of which 31 were from HIV(+) individuals). The standard and clinical strains were typed with HPLC based mycolic acid fingerprinting. RESULTS: Three polymorphisms (BamHI, BstNI and HgaI) were identified for inter-species differentiation among standard strains; of which, only HgaI was found to be useful in clinical isolates. Of the 45 isolates, 25 were M. avium and 20 were M. intracelluare. MAC isolates, which could not be differentiated by HPLC analysis, were also typed by this method. INTERPRETATION & CONCLUSION: The use of mycobacterial groES as a PCR-RFLP target for M. avium and M. intracellulare is a simple and rapid method that can complement HPLC in their differentiation.

The role of stress proteins in responses of a montane willow leaf beetle to environmental temperature variation.

The heat shock response is a critical mechanism by which organisms buffer effects of variable and unpredictable environmental temperatures. Upregulation of heat shock proteins (Hsps) increases survival after exposure to stressful conditions in nature, although benefits of Hsp expression are often balanced by costs to growth and reproductive success. Hsp-assisted folding of variant polypeptides may prevent development of unfit phenotypes; thus, some differences in Hsp expression among natural populations of ectotherms may be due to interactions between enzyme variants (allozymes) and Hsps. In the Sierra willow leaf beetle Chrysomela aeneicollis, which lives in highly variable thermal habitats at the southern edge of their range in the Eastern Sierra Nevada, California, allele frequencies at the enzyme locus phosphoglucose isomerase (PGI) vary across a climatic latitudinal gradient. PGI allozymes differ in kinetic properties,and expression of a 70 kDa Hsp differs between populations, along elevation gradients,and among PGI genotypes. Differences in Hsp70 expression among PGI genotypes correspond to differences in thermal tolerance and traits important for reproductive success, such as running speed, survival and fecundity. Thus, differential Hsp expression among genotypes may allow functionally important genetic variation to persist, allowing populations to respond effectively to environmental change.

Heat shock transcription factors regulate heat induced cell death in a rat histiocytoma.

Heat shock response is associated with the synthesis of heat shock proteins (Hsps) which is strictly regulated by different members of heat shock transcription factors (HSFs). We previously reported that a rat histiocytoma, BC-8 failed to synthesize Hsps when subjected to typical heat shock conditions (42 degrees C, 60 min). The lack of Hsp synthesis in these cells was due to a failure in HSF1 DNA binding activity. In the present study we report that BC-8 tumor cells when subjected to heat shock at higher temperature (43 degrees C, 60 min) or incubation for longer time at 42 degrees C, exhibited necrosis characteristics; however,under mild heat shock (42 degrees C, 30 min) conditions cells showed activation of autophagy. Mild heat shock treatment induced proteolysis of HSF1, and under similar conditions we observed an increase in HSF2 expression followed by its enhanced DNA binding activity. Inhibiting HSF1 proteolysis by reversible proteasome inhibition failed to inhibit heat shock induced autophagy. Compromising HSF2 expression but not HSF1 resulted in the inhibition of autophagy, suggesting HSF2 dependent activation of autophagy. We are reporting for the first time that HSF2 is heat inducible and functions in heat shock induced autophagic cell death in BC-8 tumor cells.